Быстрый заказ

Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек TNNI3K Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC113539
Размер кДНК:2508bp
Описание кДНК:Full length Clone DNA of Homo sapiens TNNI3 interacting kinase with N terminal Flag tag.
Синоним гена:CARK
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with TNNI3K qPCR primers for gene expression analysis, HP104300 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15707-ACGRBS22240
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15707-ACRRBS22240
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15707-ANGRBS22240
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15707-ANRRBS22240
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15707-CFRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15707-CHRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15707-CMRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15707-CYRBS20190
Человек TNNI3K Джин клон кДНК в вектор клонированияHG15707-GRBS5130
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15707-NFRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15707-NHRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15707-NMRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15707-NYRBS20190
Человек TNNI3K Джин ORF экспрессии кДНК клона плазмидыHG15707-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15707-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Добавить в корзинуЗапрос по оптовому заказу
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».