TNFSF18 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

TNFSF18 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TNFSF18 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

AITRL cDNA ORF Clone, Human; GITRL cDNA ORF Clone, Human; hGITRL cDNA ORF Clone, Human; TL6 cDNA ORF Clone, Human

TNFSF18 Background Information

The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.
Full Name
tumor necrosis factor (ligand) superfamily, member 18
References
  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto’s Thyroiditis. Nicot C, ed. International Journal of Molecular Sciences. 2014;15(12):21674-21686.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait