Быстрый заказ

Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TNFSF18 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005092.3
    Размер кДНК:600bp
    Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag.
    Синоним гена:TL6, AITRL, GITRL, hGITRL
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFSF18 qPCR primers for gene expression analysis, HP104622 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16080-ACGRBS15400
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16080-ACRRBS15400
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16080-CFRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16080-CHRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16080-CMRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16080-CYRBS13340
    Человек TNFSF18 Джин клон кДНК в вектор клонированияHG16080-GRBS5130
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16080-NFRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16080-NHRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16080-NMRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16080-NYRBS13340
    Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмидыHG16080-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto’s Thyroiditis. Nicot C, ed. International Journal of Molecular Sciences. 2014;15(12):21674-21686.
  • Size / Price
    Каталог: HG16080-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».