Быстрый заказ

Text Size:AAA

Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNFSF18 Информация о продукте «Клон cDNA»
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag.
Синоним гена:TL6, AITRL, GITRL, hGITRL
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16080-ACGRBS15396
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16080-ACRRBS15396
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16080-CFRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16080-CHRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16080-CMRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16080-CYRBS13343
Человек TNFSF18 Джин клон кДНК в вектор клонированияHG16080-GRBS5132
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16080-NFRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16080-NHRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16080-NMRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16080-NYRBS13343
Человек TNFSF18 Джин ORF экспрессии кДНК клона плазмидыHG16080-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16080-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.