After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNFRSF25 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_148965
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 25 with N terminal HA tag.
Синоним гена:DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12095-ACGRBS15400
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12095-ACRRBS15400
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12095-CFRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12095-CHRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12095-CMRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12095-CYRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин клон кДНК в вектор клонированияHG12095-GRBS5130
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12095-NFRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12095-NHRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12095-NMRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12095-NYRBS13340
Человек TNFRSF25/DR3/TNFRSF12 Джин ORF экспрессии кДНК клона плазмидыHG12095-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), also known as Death receptor 3 (DR3) or TNFRSF12 is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. TNFRSF25/DR3/TNFRSF12 has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this TNFRSF25 encoding gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation.

Ссылки
  • Slebioda TJ, et al. (2011) Triggering of TNFRSF25 promotes CD8? T-cell responses and anti-tumor immunity. Eur J Immunol. 41(9): 606-11.
  • Fang L, et al. (2008) Essential role of TNF receptor superfamily 25 (TNFRSF25) in the development of allergic lung inflammation. J Exp Med. 205(5): 037-48.
  • Borysenko CW, et al. (2005) Comparative modeling of TNFRSF25 (DR3) predicts receptor destabilization by a mutation linked to rheumatoid arthritis. Biochem Biophys Res Commun. 328(3): 94-9.
  • Size / Price
    Каталог: HG12095-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».