After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNFRSF21 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010241
Размер кДНК:1419bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member with C terminal Myc tag.
Синоним гена:DR6, CD358, BM-018, TNFRSF21
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12171-ACGRBS15400
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12171-ACRRBS15400
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12171-CFRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12171-CHRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12171-CMRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12171-CYRBS13340
Человек TNFRSF21/DR6 Джин клон кДНК в вектор клонированияHG12171-GRBS5130
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12171-NFRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12171-NHRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12171-NMRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12171-NYRBS13340
Человек TNFRSF21/DR6 Джин ORF экспрессии кДНК клона плазмидыHG12171-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death receptors. This type I transmembrane receptor possesses four extracellular cysteine-rich motifs and a cytoplasmic death domain. DR6 is an extensively posttranslationally modified transmembrane protein and that N- and O-glycosylations of amino acids in its extracellular part. DR6 interacts with the adaptor protein TRADD and mediates signal transduction through its death domain, and expression of DR6 in mammalian cells induces activation of both NF-kappaB and JNK and cell apoptosis. DR6 knockout mice have enhanced CD4+ T cell proliferation and Th2 cytokine production, suggested that DR6 serves as an important regulatory molecule in T-helper cell activation, and is involved in inflammation and immune regulation. DR6 is expressed ubiquitously with high expression in lymphoid organs, heart, brain and pancreas. Some tumor cells overexpress DR6, typically in conjunction with elevated anti-apoptosis molecules. DR6 may also be involved in tumor cell survival and immune evasion, which is subject to future investigations.

Ссылки
  • Pan G, et al. (1998) Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431(3): 351-6.
  • Benschop R, et al. (2009) Tumor necrosis factor receptor superfamily member 21: TNFR-related death receptor-6, DR6. Adv Exp Med Biol. 647: 186-94.
  • Klma M, et al. (2009) Functional analysis of the posttranslational modifications of the death receptor 6. Biochim Biophys Acta. 1793(10): 1579-87.
  • Size / Price
    Каталог: HG12171-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».