Быстрый заказ

Text Size:AAA

Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNFRSF13C Информация о продукте «Клон cDNA»
Размер кДНК:555bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 13C with N terminal Myc tag.
Синоним гена:BAFFR, CD268, CVID4, BAFF-R, BROMIX, prolixin
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16079-ACGRBS15400
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16079-ACRRBS15400
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16079-CFRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16079-CHRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16079-CMRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16079-CYRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин клон кДНК в вектор клонированияHG16079-GRBS5130
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16079-NFRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16079-NHRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16079-NMRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16079-NYRBS13340
Человек BAFFR / TNFRSF13C / CD268 Джин ORF экспрессии кДНК клона плазмидыHG16079-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

  • Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.
  • Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.
  • Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.
  • Size / Price
    Каталог: HG16079-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.