Быстрый заказ

Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNFRSF10B Информация о продукте «Клон cDNA»
Размер кДНК:1323bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 10b with C terminal His tag.
Участок рестрикции:KpnI + NotI (6kb + 1.37kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human TNFRSF10B Gene Plasmid Map
Human TNFRSF10B / TRAILR2 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10465-ACGRBS15400
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10465-ACRRBS15400
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10465-CFRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10465-CHRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10465-CMRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10465-CYRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин клон кДНК в вектор клонированияHG10465-MRBS5130
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10465-NFRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10465-NHRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10465-NMRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10465-NYRBS13340
Человек TRAIL R2/CD262/TNFRSF10B Джин ORF экспрессии кДНК клона плазмидыHG10465-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Size / Price
    Каталог: HG10465-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human TNFRSF10B / TRAILR2 natural ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.