Быстрый заказ

Text Size:AAA

Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNFAIP3 Информация о продукте «Клон cDNA»
Размер кДНК:2373bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor, alpha-induced protein 3 with N terminal HA tag.
Синоним гена:A20, OTUD7C, TNFA1P2, MGC104522, MGC138687, MGC138688, TNFAIP3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12089-ACGRBS16760
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12089-ACRRBS16760
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12089-ANGRBS16760
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12089-CFRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12089-CHRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12089-CMRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12089-CYRBS14710
Человек TNFAIP3 Джин клон кДНК в вектор клонированияHG12089-GRBS5130
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12089-NFRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12089-NHRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12089-NMRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12089-NYRBS14710
Человек TNFAIP3 Джин ORF экспрессии кДНК клона плазмидыHG12089-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.