Быстрый заказ

Text Size:AAA

Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TNF Информация о продукте «Клон cDNA»
Размер кДНК:702bp
Описание кДНК:Full length Clone DNA of Homo sapiens tumor necrosis factor (TNF superfamily, member 2) with C terminal Myc tag.
Синоним гена:DIF, TNFA, TNFSF2, TNF-alpha, TNF
Участок рестрикции:KpnI + XbaI (6kb + 0.75kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human TNF Gene Plasmid Map
Human TNFα Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10602-ACGRBS15396
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10602-ACRRBS15396
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10602-CFRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10602-CHRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10602-CMRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10602-CYRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин клон кДНК в вектор клонированияHG10602-MRBS5132
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10602-NFRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10602-NHRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10602-NMRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10602-NYRBS13343
Человек TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмидыHG10602-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Size / Price
    Каталог: HG10602-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human TNFα Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.