After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMOD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC064961
Размер кДНК:1056bp
Описание кДНК:Full length Clone DNA of Homo sapiens tropomodulin 2 (neuronal) DNA.
Синоним гена:NTMOD, N-TMOD
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15256-ACGRBS15400
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15256-ACRRBS15400
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15256-ANGRBS15400
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15256-ANRRBS15400
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15256-CFRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15256-CHRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15256-CMRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15256-CYRBS13340
Человек TMOD2 Джин клон кДНК в вектор клонированияHG15256-GRBS5130
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15256-NFRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15256-NHRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15256-NMRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15256-NYRBS13340
Человек TMOD2 Джин ORF экспрессии кДНК клона плазмидыHG15256-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15256-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».