After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMEM27 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC014317
Размер кДНК:669bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane protein 27.
Синоним гена:NX17, NX-17, TMEM27
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13301-ACGRBS15400
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13301-ACRRBS15400
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13301-CFRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13301-CHRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13301-CMRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13301-CYRBS13340
Человек TMEM27 Джин клон кДНК в вектор клонированияHG13301-GRBS5130
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13301-NFRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13301-NHRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13301-NMRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13301-NYRBS13340
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмидыHG13301-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

Ссылки
  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • Size / Price
    Каталог: HG13301-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».