Быстрый заказ

Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMEM27 Информация о продукте «Клон cDNA»
Размер кДНК:669bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane protein 27 with C terminal Flag tag.
Синоним гена:NX17, NX-17, TMEM27
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13301-ACGRBS15396
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13301-ACRRBS15396
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13301-CFRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13301-CHRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13301-CMRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13301-CYRBS13343
Человек TMEM27 Джин клон кДНК в вектор клонированияHG13301-GRBS5132
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13301-NFRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13301-NHRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13301-NMRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13301-NYRBS13343
Человек TMEM27 Джин ORF экспрессии кДНК клона плазмидыHG13301-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • Size / Price
    Каталог: HG13301-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.