After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMEM25 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC051841
Размер кДНК:969bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane protein 25 with N terminal Myc tag.
Синоним гена:UNQ2531/PRO6030, FLJ14399, TMEM25
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13750-ACGRBS15400
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13750-ACRRBS15400
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13750-CFRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13750-CHRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13750-CMRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13750-CYRBS13340
Человек TMEM25 Джин клон кДНК в вектор клонированияHG13750-GRBS5130
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13750-NFRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13750-NHRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13750-NMRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13750-NYRBS13340
Человек TMEM25 Джин ORF экспрессии кДНК клона плазмидыHG13750-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TMEM25 is a novel member of the immunoglobulin superfamily. Immunoglobulin superfamily members are implicated in immune responses, growth factor signaling, and cell adhesion. TMEM25 contains 1 Ig-like (immunoglobulin-like) domain and is a target of pharmacogenomics in the field of oncology and regenerative medicine. TMEM25 isoform 1, consisting of exons 1-9, encoded a 366-aa transmembrane protein. TMEM25 isoform 2, consisting of exons 1-4 and 6-9, encoded a 322-aa secreted protein. TMEM25 mRNA was expressed in brain, including cerebellar cortex and hippocampus, as well as in neuroblastoma, brain tumors, and gastric cancer. Human TMEM25 gene was located at the 11q23.3 oncogenomic recombination hotspot around the MLL amplicon and the neuroblastoma deleted region.

Ссылки
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Sugano S, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Katoh M, et al. (2004) Identification and characterization of human TMEM25 and mouse Tmem25 genes in silico. Oncol Rep. 12(2):429-33.
  • Size / Price
    Каталог: HG13750-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».