After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMEM123 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC032296
Размер кДНК:627bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane protein 123 with N terminal His tag.
Синоним гена:KCT3, PORMIN, PORIMIN, TMEM123
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13663-ACGRBS15400
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13663-ACRRBS15400
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13663-CFRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13663-CHRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13663-CMRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13663-CYRBS13340
Человек TMEM123 Джин клон кДНК в вектор клонированияHG13663-GRBS5130
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13663-NFRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13663-NHRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13663-NMRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13663-NYRBS13340
Человек TMEM123 Джин ORF экспрессии кДНК клона плазмидыHG13663-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».