After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMED7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC019349
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta.
Синоним гена:p27, CGI-109, TMED7
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13285-ACGRBS15400
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13285-ACRRBS15400
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13285-CFRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13285-CHRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13285-CMRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13285-CYRBS13340
Человек TMED7 Джин клон кДНК в вектор клонированияHG13285-GRBS5130
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13285-NFRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13285-NHRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13285-NMRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13285-NYRBS13340
Человек TMED7 Джин ORF экспрессии кДНК клона плазмидыHG13285-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13285-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».