TMED4 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

TMED4 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Human transmembrane emp24 protein transport domain conta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TMED4 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ERS25 cDNA ORF Clone, Human; GMP25iso cDNA ORF Clone, Human; HNLF cDNA ORF Clone, Human; p24alpha3 cDNA ORF Clone, Human

TMED4 Background Information

TMED4, also known as ERS25, belongs to the EMP24/GP25L family. TMED4 may play a role in the regulation of heat-shock response and apoptosis. It is involved in vesicular protein trafficking, mainly in the early secretory pathway. TMED4 may also play a role in the biosynthesis of secreted cargo including processing. It functions in the regulation of heat-shock response and apoptosis. TMED4 also is involved in endoplasmic reticulum stress response.
Full Name
transmembrane emp24 protein transport domain containing 4
References
  • Hartley JL. et al., 2001, Genome Res. 10 (11): 1788-95.
  • Matoba R. et al., 1994, Gene. 146 (2): 199-207.
  • Matsuda A. et al., 2003, Oncogene. 22 (21): 3307-18.

TMED4 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait