Быстрый заказ

Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TMED4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC057851
    Размер кДНК:684bp
    Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta with N terminal Myc tag.
    Синоним гена:HNLF, ERS25, TMED4
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TMED4 qPCR primers for gene expression analysis, HP102406 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13729-ACGRBS15400
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13729-ACRRBS15400
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13729-CFRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13729-CHRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13729-CMRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13729-CYRBS13340
    Человек TMED4 / ERS25 Джин клон кДНК в вектор клонированияHG13729-GRBS5130
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13729-NFRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13729-NHRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13729-NMRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13729-NYRBS13340
    Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмидыHG13729-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    TMED4, also known as ERS25, belongs to the EMP24/GP25L family. TMED4 may play a role in the regulation of heat-shock response and apoptosis. It is involved in vesicular protein trafficking, mainly in the early secretory pathway. TMED4 may also play a role in the biosynthesis of secreted cargo including processing. It functions in the regulation of heat-shock response and apoptosis. TMED4 also is involved in endoplasmic reticulum stress response.

    Ссылки
  • Hartley JL. et al., 2001, Genome Res. 10 (11): 1788-95.
  • Matoba R. et al., 1994, Gene. 146 (2): 199-207.
  • Matsuda A. et al., 2003, Oncogene. 22 (21): 3307-18.
  • Size / Price
    Каталог: HG13729-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».