After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMED4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC057851
Размер кДНК:684bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta with N terminal Myc tag.
Синоним гена:HNLF, ERS25, TMED4
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13729-ACGRBS15400
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13729-ACRRBS15400
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13729-CFRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13729-CHRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13729-CMRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13729-CYRBS13340
Человек TMED4 / ERS25 Джин клон кДНК в вектор клонированияHG13729-GRBS5130
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13729-NFRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13729-NHRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13729-NMRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13729-NYRBS13340
Человек TMED4 / ERS25 Джин ORF экспрессии кДНК клона плазмидыHG13729-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TMED4, also known as ERS25, belongs to the EMP24/GP25L family. TMED4 may play a role in the regulation of heat-shock response and apoptosis. It is involved in vesicular protein trafficking, mainly in the early secretory pathway. TMED4 may also play a role in the biosynthesis of secreted cargo including processing. It functions in the regulation of heat-shock response and apoptosis. TMED4 also is involved in endoplasmic reticulum stress response.

Ссылки
  • Hartley JL. et al., 2001, Genome Res. 10 (11): 1788-95.
  • Matoba R. et al., 1994, Gene. 146 (2): 199-207.
  • Matsuda A. et al., 2003, Oncogene. 22 (21): 3307-18.
  • Size / Price
    Каталог: HG13729-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».