After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMED1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC002443
Размер кДНК:684bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta.
Синоним гена:ST2L, Tp24, Il1rl1l, IL1RL1LG, TMED1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13302-ACGRBS15400
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13302-ACRRBS15400
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13302-CFRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13302-CHRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13302-CMRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13302-CYRBS13340
Человек TMED1 Джин клон кДНК в вектор клонированияHG13302-GRBS5130
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13302-NFRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13302-NHRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13302-NMRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13302-NYRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмидыHG13302-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TMED1 belongs to the EMP24/GP25L family. It contains 1 GOLD domain and is widely expressed. TMED1 binds to its receptor IL1RL1 and results in the activation of DNA binding by nuclear factor NF-kappa-B or transcription from the IL8 promoter and most likely requires other proteins to elicit these activities. Dendritic cells from Peyer's patches (but not from spleen) express TMED1 in response to treatment with LPS. TMED1 may play a role in vesicular protein trafficking, mainly in the early secretory pathway. It may act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.

Ссылки
  • Colland F, et al. (2004) Functional Proteomics Mapping of a Human Signaling Pathway. Genome Res. 14(7):1324-32.
  • Gerhard DS, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».