Быстрый заказ

Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TMED1 Информация о продукте «Клон cDNA»
Размер кДНК:684bp
Описание кДНК:Full length Clone DNA of Homo sapiens transmembrane emp24 protein transport domain conta with C terminal Flag tag.
Синоним гена:ST2L, Tp24, Il1rl1l, IL1RL1LG, TMED1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13302-ACGRBS15400
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13302-ACRRBS15400
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13302-CFRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13302-CHRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13302-CMRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13302-CYRBS13340
Человек TMED1 Джин клон кДНК в вектор клонированияHG13302-GRBS5130
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13302-NFRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13302-NHRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13302-NMRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13302-NYRBS13340
Человек TMED1 Джин ORF экспрессии кДНК клона плазмидыHG13302-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TMED1 belongs to the EMP24/GP25L family. It contains 1 GOLD domain and is widely expressed. TMED1 binds to its receptor IL1RL1 and results in the activation of DNA binding by nuclear factor NF-kappa-B or transcription from the IL8 promoter and most likely requires other proteins to elicit these activities. Dendritic cells from Peyer's patches (but not from spleen) express TMED1 in response to treatment with LPS. TMED1 may play a role in vesicular protein trafficking, mainly in the early secretory pathway. It may act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.

  • Colland F, et al. (2004) Functional Proteomics Mapping of a Human Signaling Pathway. Genome Res. 14(7):1324-32.
  • Gerhard DS, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Size / Price
    Каталог: HG13302-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.