Быстрый заказ

Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TLR4 Информация о продукте «Клон cDNA»
Размер кДНК:2520bp
Описание кДНК:Full length Clone DNA of Homo sapiens toll-like receptor 4, transcript variant 1 with N terminal Myc tag.
Синоним гена:TOLL, CD284, hToll, ARMD10
Участок рестрикции:KpnI + NotI (6kb + 2.54kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human TLR4 Gene Plasmid Map
Human TLR4 transcript variant 1 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10146-ACGRBS22240
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10146-ACRRBS22240
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10146-CFRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10146-CHRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10146-CMRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10146-CYRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин клон кДНК в вектор клонированияHG10146-MRBS5130
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10146-NFRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10146-NHRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10146-NMRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10146-NYRBS20190
Человек TLR4 / TLR-4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10146-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TLR4, also known as TLR-4, is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR4 is most abundantly expressed in placenta, and in myelomonocytic subpopulation of the leukocytes. TLR 4 has also been designated as CD284 (cluster of differentiation 284). It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. TLR4 Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). It acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It is also involved in LPS-independent inflammatory responses triggered by Ni(2+).

  • Re, Fabio, et al. (2002) Monomeric recombinant MD-2 binds toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem. 277(26):23427-32.
  • Shimazu, R, et al. (1999) MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4. J Exp Med. 189(11):1777-82.
  • Blanco, A M, et al. (2005) Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. Journal of immunology. 175(10):6893-9.
  • Size / Price
    Каталог: HG10146-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.