Быстрый заказ

Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human THBS1 Информация о продукте «Клон cDNA»
Размер кДНК:3513bp
Описание кДНК:Full length Clone DNA of Homo sapiens thrombospondin 1 with N terminal HA tag.
Синоним гена:TPX1, TSP1, GAPDL5, CRISP-2, MGC111136
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10508-ACGRBS25659
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10508-ACRRBS25659
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10508-CFRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10508-CHRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10508-CMRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10508-CYRBS23607
Человек Thrombospondin-1/TSP1 Джин клон кДНК в вектор клонированияHG10508-MRBS5132
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10508-NFRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10508-NHRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10508-NMRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10508-NYRBS23607
Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмидыHG10508-UTRBS23607
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10508-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.