Быстрый заказ

Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек THBS1 Информация о продукте «Клон cDNA»
    Размер кДНК:3513bp
    Описание кДНК:Full length Clone DNA of Homo sapiens thrombospondin 1 with N terminal HA tag.
    Синоним гена:TPX1, TSP1, GAPDL5, CRISP-2, MGC111136
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with THBS1 qPCR primers for gene expression analysis, HP100529 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10508-ACGRBS25660
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10508-ACRRBS25660
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10508-CFRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10508-CHRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10508-CMRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10508-CYRBS23610
    Человек Thrombospondin-1/TSP1 Джин клон кДНК в вектор клонированияHG10508-MRBS5130
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10508-NFRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10508-NHRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10508-NMRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10508-NYRBS23610
    Человек Thrombospondin-1/TSP1 Джин ORF экспрессии кДНК клона плазмидыHG10508-UTRBS23610
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10508-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.