Быстрый заказ

Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TGFBR1 Информация о продукте «Клон cDNA»
Размер кДНК:1512bp
Описание кДНК:Full length Clone DNA of Homo sapiens transforming growth factor, beta receptor 1 with C terminal His tag.
Синоним гена:AAT5, ALK5, SKR4, ALK-5, LDS1A, LDS2A, TGFR-1, ACVRLK4, TGFBR1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10459-ACGRBS16760
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10459-ACRRBS16760
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10459-CFRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10459-CHRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10459-CMRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10459-CYRBS14710
Человек TGFBR1 / ALK-5 Джин клон кДНК в вектор клонированияHG10459-MRBS5130
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10459-M-FRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10459-NFRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10459-NHRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10459-NMRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10459-NYRBS14710
Человек TGFBR1 / ALK-5 Джин ORF экспрессии кДНК клона плазмидыHG10459-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I , Serine / threonine-protein kinase receptor R4, Activin receptor-like kinase 5, SKR4, ALK-5, and TGFBR1, is a single-pass type I membrane protein which belongs to the protein kinase superfamily and TGFB receptor subfamily. TGFBR1 / ALK-5 is found in all tissues examined. It is most abundant in placenta and least abundant in brain and heart. TGF-beta functions as a tumor suppressor by inhibiting the cell cycle in the G1 phase. Administration of TGF-beta is able to protect against mammary tumor development in transgenic mouse models in vivo. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers, with the majority of colon and gastric cancers being caused by an inactivating mutation of TGF-beta RII. On ligand binding, TGFBR1 / ALK-5 forms a receptor complex consisting of two type I I and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which auto-phosphorylate, then bind and activate SMAD transcriptional regulators. TGF-beta signaling via TGFBR1 / ALK-5 is not required in myocardial cells during mammalian cardiac development, but plays an irreplaceable cell-autonomous role regulating cellular communication, differentiation and proliferation in endocardial and epicardial cells. Defects in TGFBR1 / ALK-5 are the cause of Loeys-Dietz syndrome type 1A (LDS1A), Loeys-Dietz syndrome type 2A (LDS2A), and aortic aneurysm familial thoracic type 5 (AAT5).

  • Seki T, et al. (2006) Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest. 86(2): 116-29. et al.
  • Piek E, et al. (1999) TGF-(beta) type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J Cell Sci. 112 (24): 4557-68. et al.
  • Dudas M, et al. (2004) Tgf-beta3-induced palatal fusion is mediated by Alk-5/Smad pathway. Dev Biol. 266(1): 96-108.
  • Size / Price
    Каталог: HG10459-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.