After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TGFBI Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000358.2
Размер кДНК:2052bp
Описание кДНК:Full length Clone DNA of Homo sapiens transforming growth factor, beta-induced, 68kDa with N terminal Flag tag.
Синоним гена:CSD, CDB1, CDG2, CSD1, CSD2, CSD3, EBMD, LCD1, BIGH3, CDGG1
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10569-ACGRBS16760
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10569-ACRRBS16760
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10569-CFRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10569-CHRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10569-CMRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10569-CYRBS14710
Человек TGFBI Джин клон кДНК в вектор клонированияHG10569-MRBS5130
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10569-M-FRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10569-NFRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10569-NHRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10569-NMRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10569-NYRBS14710
Человек TGFBI Джин ORF экспрессии кДНК клона плазмидыHG10569-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TGFBI is an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. TGFBI plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. TGFBI is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in TGFBI are associated with multiple types of corneal dystrophy. TGFBI can bind to type I, II, and IV collagens. This adhesion protein may play an important role in cell-collagen interactions. In cartilage, TGFBI may be involved in endochondral bone formation. Loss of the TGFBI is sufficient to induce specific resistance.

Ссылки
  • Kannabiran C, et al. (2006) TGFBI gene mutations in corneal dystrophies. Hum Mutat. 27(7): 615-25.
  • Size / Price
    Каталог: HG10569-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».