Быстрый заказ

Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TGFB1 Информация о продукте «Клон cDNA»
Размер кДНК:1173bp
Описание кДНК:Full length Clone DNA of Homo sapiens transforming growth factor, beta 1 with N terminal Myc tag.
Синоним гена:CED, DPD1, TGFB, TGFbeta, TGFB1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10804-ACGRBS15400
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10804-ACRRBS15400
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10804-CFRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10804-CHRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10804-CMRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10804-CYRBS13340
Человек TGF-beta 1/TGFB1 Джин клон кДНК в вектор клонированияHG10804-GRBS5130
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10804-NFRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10804-NHRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10804-NMRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10804-NYRBS13340
Человек TGF-beta 1/TGFB1 Джин ORF экспрессии кДНК клона плазмидыHG10804-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-γ, tumor necrosis factor-alpha and various interleukins. It can also decrease the expression levels of cytokine receptors. Meanwhile, TGF-beta 1 also increases the expression of certain cytokines in T cells and promotes their proliferation, particularly if the cells are immature. TGF-beta 1 also inhibits proliferation and stimulates apoptosis of B cells, and plays a role in controlling the expression of antibody, transferrin and MHC class II proteins on immature and mature B cells. As for myeloid cells, TGF-beta 1can inhibit their proliferation and prevent their production of reactive oxygen and nitrogen intermediates. However, as with other cell types, TGF-beta 1 also has the opposite effect on cells of myeloid origin. TGF-beta 1 is a multifunctional protein that controls proliferation, differentiation and other functions in many cell types. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Once cells lose their sensitivity to TGF-beta1-mediated growth inhibition, autocrine TGF-beta signaling can promote tumorigenesis. Elevated levels of TGF-beta1 are often observed in advanced carcinomas, and have been correlated with increased tumor invasiveness and disease progression.

  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.
  • Size / Price
    Каталог: HG10804-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.