Быстрый заказ

Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TFPI2 Информация о продукте «Клон cDNA»
Размер кДНК:708bp
Описание кДНК:Full length Clone DNA of Homo sapiens tissue factor pathway inhibitor 2 with N terminal Flag tag.
Синоним гена:PP5, REF1, TFPI-2, FLJ21164, TFPI2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10545-ACGRBS15400
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10545-ACRRBS15400
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10545-ANGRBS15400
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10545-ANRRBS15400
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10545-CFRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10545-CHRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10545-CMRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10545-CYRBS13340
Человек TFPI2 Джин клон кДНК в вектор клонированияHG10545-MRBS5130
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10545-NFRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10545-NHRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10545-NMRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10545-NYRBS13340
Человек TFPI2 Джин ORF экспрессии кДНК клона плазмидыHG10545-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tissue factor pathway inhibitor-2 (TFPI2), a member of the Kunitz-type serine proteinase inhibitor family, is a structural homologue of tissue factor pathway inhibitor (TFPI). It is a 32 kDa matrix-associated glycoprotein consisting of a short amino-terminal region, three tandem Kunitz-type domains and a positively charged carboxy-terminal tail. TFPI2 inhibits plasmin-dependent activation of several metalloproteinases. TFPI2 is highly abundant in the full-term placenta and widely expressed in various adult human tissues, such as the liver, skeletal muscle, heart, kidney, and pancreas. The expression of TFPI2 in tumors is inversely related to an increasing degree of malignancy, which may suggest a role for TFPI2 in the maintenance of tumor stability and inhibition of the growth of neoplasms. TFPI2 inhibits the tissue factor/factor VIIa (TF/VIIa) complex and a wide variety of serine proteinases including plasmin, plasma kallikrein, factor XIa, trypsin, and chymotrypsin. TFPI2 is involved in regulating pericellular proteases implicated in a variety of physiologic and pathologic processes including cancer cell invasion, vascular inflammation, and atherosclerosis. TFPI2 has also been shown to induce apoptosis and inhibit angiogenesis, which may contribute significantly to tumor growth inhibition.

  • Peerschke EI, et al. (2004) Tissue factor pathway inhibitor-2 (TFPI-2) recognizes the complement and kininogen binding protein gC1qR/p33 (gC1qR): implications for vascular inflammation. Thromb Haemost. 92(4): 811-9.
  • Rollin J, et al. (2005) Expression and methylation status of tissue factor pathway inhibitor-2 gene in non-small-cell lung cancer. Br J Cancer. 92(4): 775-83.
  • Chand HS, et al. (2005) Structure, function and biology of tissue factor pathway inhibitor-2. Thromb Haemost. 94(6): 1122-30.
  • Sierko E, et al. (2007) The role of tissue factor pathway inhibitor-2 in cancer biology. Semin Thromb Hemost. 33(7): 653-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.