Быстрый заказ

Text Size:AAA

Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TFPI Информация о продукте «Клон cDNA»
Размер кДНК:915bp
Описание кДНК:Full length Clone DNA of Homo sapiens tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) with N terminal Flag tag.
Синоним гена:EPI, TFI, LACI, TFPI1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10564-ACGRBS15400
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10564-ACRRBS15400
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10564-CFRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10564-CHRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10564-CMRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10564-CYRBS13340
Человек TFPI Джин клон кДНК в вектор клонированияHG10564-MRBS5130
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10564-M-FRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10564-NFRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10564-NHRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10564-NMRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10564-NYRBS13340
Человек TFPI Джин ORF экспрессии кДНК клона плазмидыHG10564-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tissue factor pathway inhibitor (TFPI) is the natural inhibitor of TF coagulant and signaling activities. It is a Kunitz-type serine proteinase inhibitor that down-regulates tissue factor-initiated blood coagulation. With its Kunitz domains, TFPI exhibits significant homology with human inter-alpha-trypson inhibitor and bovin basic pancreatic trypsin inhibitor. TFPI is the natural inhibitor of TF coagulant and signaling activities. The importance of TFPI in the regulation of blood coagulation is emphasized by how its activity is modulated in human disease. In a factor (F) Xa-dependent feedback system, TFPI binds directly and inhibits the TF-FVII/FVIIa complex. Normally, TFPI exists in plasma both as a full-length molecule and as variably carboxy-terminal truncated forms. TFPI also circulates in complex with plasma lipoproteins. The levels and the dual inhibitor effect of TFPI on FXa and TF-FVII/FVIIa complex offers insight into the mechanisms of various pathological conditions triggered by TF. TFPI may play an important role in modulating TF-induced thrombogenesis and it may also provide a unique therapeutic approach for prophylaxis and/or treatment of various diseases. In addition, Studies have shown that TFPI exhibits antiangiogenic and antimetastatic effects in vitro and in vivo. In animal models of experimental metastasis, both circulating and tumor cell-associated TFPI are shown to significantly reduce tumor cell-induced coagulation activation and lung metastasis.

  • Lwaleed BA, et al. (2006) Tissue factor pathway inhibitor: structure, biology and involvement in disease. J Pathol. 208(3): 327-39.
  • Amirkhosravi A, et al. (2007) The role of tissue factor pathway inhibitor in tumor growth and metastasis. Semin Thromb Hemost. 33(7): 643-52.
  • Maroney SA, et al. (2008) Expression of tissue factor pathway inhibitor by endothelial cells and platelets. Transfus Apher Sci. 38(1): 9-14.
  • Size / Price
    Каталог: HG10564-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.