Быстрый заказ

Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TFAP2C Информация о продукте «Клон cDNA»
Размер кДНК:1353bp
Описание кДНК:Full length Clone DNA of Homo sapiens transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) with N terminal Myc tag.
Синоним гена:ERF1, TFAP2G, hAP-2g, AP2-GAMMA, TFAP2C
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13115-ACGRBS15400
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13115-ACRRBS15400
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13115-ANGRBS15400
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13115-ANRRBS15400
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13115-CFRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13115-CHRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13115-CMRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13115-CYRBS13340
Человек TFAP2C / AP2-GAMMA Джин клон кДНК в вектор клонированияHG13115-GRBS5130
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13115-NFRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13115-NHRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13115-NMRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13115-NYRBS13340
Человек TFAP2C / AP2-GAMMA Джин ORF экспрессии кДНК клона плазмидыHG13115-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. TFAP2C may be prognostic indicators for patients with breast tumors. TFAP2C gene has been tested for association to diseases (Breast Neoplasms; Carcinoma) and proposed to participate in processes (cell-cell signaling, male gonad development, regulation of transcription from RNA polymerase II promoter). Proteins are expected to have molecular functions (DNA binding, protein binding, protein dimerization activity, transcription factor activity) and to localize in various compartments (membrane, nucleus).

  • Woodfield GW, et al. (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure. Clin Cancer Res. 15 (11): 3672-9.
  • Zhao C, et al. (2003) Elevated expression levels of NCOA3, TOP1, and TFAP2C in breast tumors as predictors of poor prognosis. Cancer. 98 (1): 18-23.
  • Woodfield GW, et al. (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling. Cancer Res. 67 (18): 8439-43.
  • Penna E, et al. (2011) microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 30 (10): 1990-2007.
  • Woodfield GW, et al. (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells. Genes Chromosomes Cancer. 49 (10): 948-62.
  • Size / Price
    Каталог: HG13115-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.