TIE2 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

TIE2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3375 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human TEK tyrosine kinase, endothelial.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI+NotI(6.1kb+3.38kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TIE2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIE2 cDNA ORF Clone, Human, untagged: Validated Images

TIE2 cDNA ORF Clone, Human, untagged: Alternative Names

CD202B cDNA ORF Clone, Human; TIE-2 cDNA ORF Clone, Human; TIE2 cDNA ORF Clone, Human; VMCM cDNA ORF Clone, Human; VMCM1 cDNA ORF Clone, Human

TIE2 Background Information

TEK, or TIE-2, is an endothelial cell-specific receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. Targeted mutagenesis of both Tek and its agonistic ligand, Angiopoietin-1, result in embryonic lethality, demonstrating that the signal transduction pathways mediated by this receptor are crucial for normal embryonic development. TEK signaling is indispensable for the development of the embryonic vasculature and suggests that TEK signaling may also be required for the development of the tumor vasculature.
Full Name
TEK tyrosine kinase, endothelial
References
  • Jones N, et al. (1998) The Tek / Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene. 17(9): 1097-108.
  • Sato A, et al. (1998) Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells. Int Immunol. 10(8): 1217-27.
  • Huang L, et al. (1995) GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK / TIE2 receptor tyrosine kinase. Oncogene. 11(10): 2097-103.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait