Быстрый заказ

Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TCN2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000355.2
Размер кДНК:1284bp
Описание кДНК:Full length Clone DNA of Homo sapiens transcobalamin II; macrocytic anemia with N terminal Flag tag.
Синоним гена:TC2, D22S676, D22S750
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-TCN2
Участок рестрикции:KpnI + XbaI (6kb + 1.32kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human TCN2 Gene Plasmid Map
Human TCN2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10566-ACGRBS15400
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10566-ACRRBS15400
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10566-CFRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10566-CHRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10566-CMRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10566-CYRBS13340
Человек TCN2 Джин клон кДНК в вектор клонированияHG10566-MRBS5130
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10566-NFRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10566-NHRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10566-NMRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10566-NYRBS13340
Человек TCN2 Джин ORF экспрессии кДНК клона плазмидыHG10566-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Transcobalamin II, also known as TCN2 and TC II, is a plasma protein that binds cobalamin (Cbl; vitamin B12) as it is absorbed in the terminal ileum and distributes to tissues. The circulating transcobalamin II-cobalamin complex binds to receptors on the plasma membrane of tissue cells and is then internalized by receptor-mediated endocytosis. Transcobalamin II is a non-glycolated secretory protein of molecular mass 43 kDa. Its plasma membrane receptor (TC II-R) is a heavily glycosylated protein with a monomeric molecular mass of 62 kDa. Human TCN2 gene is composed of nine exons and eight introns spanning approximately 20 kb with multiple potential transcription start sites. A number of genetic abnormalities are characterized either by a failure to express TCN2 or by synthesis of an abnormal protein. The TCN2 deficiency results in cellular cobalamin deficiency, an early onset of megaloblastic anaemia, and neurological abnormalities.

Ссылки
  • Rothenberg, S. P. et al., 1995, Baillieres Clin Haematol. 8 (3):499-514.
  • Bibi, H. et al., 1999, J Inherit Metab Dis. 22 (7):765-772.
  • Seetharam,B. et al.,2000, Vitam Horm. 59 :337-366. 
  • Size / Price
    Каталог: HG10566-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human TCN2 natural ORF mammalian expression plasmid, N-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».