Быстрый заказ

Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TCF4 Информация о продукте «Клон cDNA»
Размер кДНК:2058 bp
Описание кДНК:Full length Clone DNA of Homo sapiens transcription factor 4 with N terminal HA tag.
Синоним гена:bHLHb19,E2-2,ITF-2,ITF2,PTHS,SEF-2,SEF2,SEF2-1,SEF2-1A,SEF2-1B,SEF2-1D,TCF-4
Участок рестрикции:KpnI + XbaI(6kb+2.06kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12096-ACGRBS16760
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12096-ACRRBS16760
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12096-ANGRBS16760
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12096-ANRRBS16760
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12096-CFRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12096-CHRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12096-CMRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12096-CYRBS14710
Человек TCF4/E2-2 Джин клон кДНК в вектор клонированияHG12096-GRBS5130
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12096-NFRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12096-NHRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12096-NMRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12096-NYRBS14710
Человек TCF4/E2-2 Джин ORF экспрессии кДНК клона плазмидыHG12096-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12096-NY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.