TCF25 cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

TCF25 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2031 bp
Description
Full length Clone DNA of Human transcription factor 25 (basic helix-loop-helix) with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TCF25 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

FKSG26 cDNA ORF Clone, Human; hKIAA1049 cDNA ORF Clone, Human; Hulp1 cDNA ORF Clone, Human; NULP1 cDNA ORF Clone, Human; PRO2620 cDNA ORF Clone, Human

TCF25 Background Information

Full Name
transcription factor 25 (basic helix-loop-helix)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait