Быстрый заказ

Человек TBCB Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TBCB Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC005969
    Размер кДНК:735bp
    Описание кДНК:Full length Clone DNA of Homo sapiens tubulin folding cofactor B.
    Синоним гена:CG22, CKAP1, CKAPI, MGC14625
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TBCB qPCR primers for gene expression analysis, HP102910 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14260-ACGRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14260-ACRRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14260-ANGRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14260-ANRRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14260-CFRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14260-CHRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14260-CMRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14260-CYRBS13340
    Человек TBCB Джин клон кДНК в вектор клонированияHG14260-GRBS5130
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14260-NFRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14260-NHRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14260-NMRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14260-NYRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмидыHG14260-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

    Ссылки
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Каталог: HG14260-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».