Быстрый заказ

Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TBCB Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC005969
    Размер кДНК:735bp
    Описание кДНК:Full length Clone DNA of Homo sapiens tubulin folding cofactor B with N terminal His tag.
    Синоним гена:CG22, CKAP1, CKAPI, MGC14625
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TBCB qPCR primers for gene expression analysis, HP102910 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14260-ACGRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14260-ACRRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14260-ANGRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14260-ANRRBS15400
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14260-CFRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14260-CHRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14260-CMRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14260-CYRBS13340
    Человек TBCB Джин клон кДНК в вектор клонированияHG14260-GRBS5130
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14260-NFRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14260-NHRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14260-NMRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14260-NYRBS13340
    Человек TBCB Джин ORF экспрессии кДНК клона плазмидыHG14260-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

    Ссылки
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Каталог: HG14260-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».