After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TBCB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005969
Размер кДНК:735bp
Описание кДНК:Full length Clone DNA of Homo sapiens tubulin folding cofactor B with N terminal His tag.
Синоним гена:CG22, CKAP1, CKAPI, MGC14625
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14260-ACGRBS15400
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14260-ACRRBS15400
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14260-ANGRBS15400
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14260-ANRRBS15400
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14260-CFRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14260-CHRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14260-CMRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14260-CYRBS13340
Человек TBCB Джин клон кДНК в вектор клонированияHG14260-GRBS5130
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14260-NFRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14260-NHRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14260-NMRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14260-NYRBS13340
Человек TBCB Джин ORF экспрессии кДНК клона плазмидыHG14260-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

Ссылки
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Каталог: HG14260-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».