After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TBCA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018210
Размер кДНК:327bp
Описание кДНК:Full length Clone DNA of Homo sapiens tubulin folding cofactor A with C terminal Flag tag.
Синоним гена:TBCA
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13918-ACGRBS15400
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13918-ACRRBS15400
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13918-ANGRBS15400
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13918-ANRRBS15400
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13918-CFRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13918-CHRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13918-CMRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13918-CYRBS13340
Человек Tubulin folding cofactor A Джин клон кДНК в вектор клонированияHG13918-GRBS5130
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13918-NFRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13918-NHRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13918-NMRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13918-NYRBS13340
Человек Tubulin folding cofactor A Джин ORF экспрессии кДНК клона плазмидыHG13918-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tubulin folding cofactor A belongs to the TBCA family. It is one of four proteins (cofactors A, D, E, and C) involved in the early step of the tubulin folding pathway. These proteins can fold intermediates and finally lead to correctly folded beta-tubulin. It is believed that tubulin folding cofactors A and D play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Tubulin folding cofactor E binds to the cofactor D/beta-tubulin complex; interaction with tubulin folding cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state.

Ссылки
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Irwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Каталог: HG13918-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».