Быстрый заказ

Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек TAF9 Информация о продукте «Клон cDNA»
Размер кДНК:795bp
Описание кДНК:Full length Clone DNA of Homo sapiens TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa with N terminal His tag.
Синоним гена:TAF2G, TAFII31, TAFII32, MGC:5067, TAFII-31, TAFII-32, TAFIID32, STAF31>32
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16493-ACGRBS15400
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16493-ACRRBS15400
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16493-ANGRBS15400
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16493-ANRRBS15400
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16493-CFRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16493-CHRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16493-CMRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16493-CYRBS13340
Человек TAF9 Джин клон кДНК в вектор клонированияHG16493-GRBS5130
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16493-NFRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16493-NHRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16493-NMRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16493-NYRBS13340
Человек TAF9 Джин ORF экспрессии кДНК клона плазмидыHG16493-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16493-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.