Быстрый заказ

Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TAF7 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005642.2
    Размер кДНК:1050bp
    Описание кДНК:Full length Clone DNA of Homo sapiens TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa with N terminal HA tag.
    Синоним гена:TAF2F, TAFII55
    Виды:Human
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TAF7 qPCR primers for gene expression analysis, HP105162 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16413-ACGRBS15400
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16413-ACRRBS15400
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16413-ANGRBS15400
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16413-ANRRBS15400
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16413-CFRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16413-CHRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16413-CMRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16413-CYRBS13340
    Человек TAF7 Джин клон кДНК в вектор клонированияHG16413-GRBS5130
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16413-NFRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16413-NHRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16413-NMRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16413-NYRBS13340
    Человек TAF7 Джин ORF экспрессии кДНК клона плазмидыHG16413-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16413-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».