Быстрый заказ

Text Size:AAA

Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TACC3 Информация о продукте «Клон cDNA»
Размер кДНК:2517bp
Описание кДНК:Full length Clone DNA of Homo sapiens transforming, acidic coiled-coil containing protein 3 with N terminal His tag.
Синоним гена:ERIC1, MGC117382, MGC133242, TACC3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11376-ACGRBS22238
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11376-ACRRBS22238
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11376-ANGRBS22238
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11376-ANRRBS22238
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11376-CFRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11376-CHRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11376-CMRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11376-CYRBS20185
Человек TACC3 Джин клон кДНК в вектор клонированияHG11376-MRBS5132
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11376-NFRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11376-NHRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11376-NMRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11376-NYRBS20185
Человек TACC3 Джин ORF экспрессии кДНК клона плазмидыHG11376-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11376-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.