Быстрый заказ

Text Size:AAA

Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SPP1 Информация о продукте «Клон cDNA»
Размер кДНК:945bp
Описание кДНК:Full length Clone DNA of Homo sapiens secreted phosphoprotein 1, transcript variant 1 with C terminal Flag tag.
Синоним гена:OPN, BNSP, BSPI, ETA-1, MGC110940
Участок рестрикции:KpnI + XbaI (6kb + 1kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SPP1 Gene Plasmid Map
Human Spp1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human SPP1 Gene Expression validated Image
Human Spp1 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10352-ACGRBS15400
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10352-ACRRBS15400
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10352-CFRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10352-CHRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10352-CMRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10352-CYRBS13340
Человек OPN/Osteopontin Джин клон кДНК в вектор клонированияHG10352-MRBS5130
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10352-NFRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10352-NHRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10352-NMRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10352-NYRBS13340
Человек OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмидыHG10352-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Size / Price
    Каталог: HG10352-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human Spp1 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag
    • Human Spp1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.