Быстрый заказ

Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

  • Human Serum Albumin / HSA / ALB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
  • Human Serum Albumin / HSA / ALB natural ORF mammalian expression plasmid, C-Flag tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек ALB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000477.5
Размер кДНК:1830bp
Описание кДНК:Full length Clone DNA of Homo sapiens albumin with C terminal Flag tag.
Синоним гена:PRO0883, PRO0903, PRO1341, DKFZp779N1935, ALB
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-ALB-Flag
Участок рестрикции:KpnI + NotI (6kb + 1.88kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation 135 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ALB qPCR primers for gene expression analysis, HP100843 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ALB Gene Plasmid Map
Human Serum Albumin / HSA / ALB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Человек ALB Gene Expression validated Image
Human Serum Albumin / HSA / ALB natural ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10968-ACGRBS16760
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10968-ACRRBS16760
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10968-CFRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10968-CHRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10968-CMRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10968-CYRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин клон кДНК в вектор клонированияHG10968-GRBS5130
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10968-NFRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10968-NHRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10968-NMRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10968-NYRBS14710
Человек Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмидыHG10968-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10968-CF
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».