Быстрый заказ

Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SERPINC1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_000488.2
    Размер кДНК:1395bp
    Описание кДНК:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade C (antithrombin), member 1 with N terminal Myc tag.
    Синоним гена:AT3, ATIII, MGC22579
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SerpinC1 qPCR primers for gene expression analysis, HP100213 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10142-ACGRBS15400
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10142-ACRRBS15400
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10142-CFRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10142-CHRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10142-CMRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10142-CYRBS13340
    Человек Antithrombin III/ATIII Джин клон кДНК в вектор клонированияHG10142-MRBS5130
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10142-M-FRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмидыHG10142-M-NRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10142-NFRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10142-NHRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10142-NMRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10142-NYRBS13340
    Человек Antithrombin III/ATIII Джин ORF экспрессии кДНК клона плазмидыHG10142-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    SerpinC1, also known as antithrombin III (AT III), is a member of the serpin superfamily of serine protease inhibitors, and has been found to be a marker for disseminated intravascular coagulation (DIC) and to be of prognostic significance in septic patients. SerpinC1 synthesized in the liver is the principal plasma serpin of blood coagulation proteases and inhibits thrombin and other factors such as Xa by the formation of covalently linked complexes. Thus it is one of the most important coagulation inhibitors and the fundamental enzyme for the therapeutical action of heparin. In common with SerpinA5 and D1, the inhibitory activity of SerpinC1 undergoes a dramatic increase in the presence of heparin and other glycosaminoglycans. ATIII mediates the promotion of prostaglandin release, an inhibitor of leucocyte activation and downregulator of many proinflammatory cytokines. Antithrombin III exerts anti-inflammatory properties in addition to its anti-coagulative mechanisms. In animal models of sepsis, ATIII affected cytokine plasma concentrations with a decrease of pro-inflammatory cytokines. The deficiency or functional abnormality of ATIII may result in an increased risk of thromboembolic disease, such as deep vein thrombosis and pulmonary embolism. In addition, it has been reported that SerpinC1 can alter or influence inflammatory processes via inhibition of NF-κB activation or actin polymerization.

    Ссылки
  • de Sousa JC, et al. (1991) Antithrombin III. Physiologic, physiopathologic and laboratory aspects. Rev Port Cardiol. 10(9): 693-9.
  • Totzke G, et al. (2001) Antithrombin III enhances inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Cell Immunol. 208(1): 1-8.
  • Ostermann H. (2002) Antithrombin III in Sepsis. New evidences and open questions. Minerva Anestesiol. 68(5): 445-8.
  • Caglikulekci M, et al. (2004) Effect of antithrombin-III (AT-III) on intestinal epithelium changes related to obstructive icterus: experimental study in rats. Ann Chir. 129(5): 273-7.
  • Size / Price
    Каталог: HG10142-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».