After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SYT9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC046367
Размер кДНК:1476bp
Описание кДНК:Full length Clone DNA of Homo sapiens synaptotagmin IX DNA.
Синоним гена:SYT9
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15221-ACGRBS15400
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15221-ACRRBS15400
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15221-ANGRBS15400
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15221-ANRRBS15400
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15221-CFRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15221-CHRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15221-CMRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15221-CYRBS13340
Человек SYT9 Джин клон кДНК в вектор клонированияHG15221-GRBS5130
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15221-NFRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15221-NHRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15221-NMRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15221-NYRBS13340
Человек SYT9 Джин ORF экспрессии кДНК клона плазмидыHG15221-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».