Быстрый заказ

Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SYT6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC044948
Размер кДНК:1278bp
Описание кДНК:Full length Clone DNA of Homo sapiens synaptotagmin VI DNA.
Синоним гена:sytVI
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15218-ACGRBS15400
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15218-ACRRBS15400
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15218-ANGRBS15400
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15218-ANRRBS15400
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15218-CFRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15218-CHRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15218-CMRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15218-CYRBS13340
Человек SYT6 / Synaptotagmin VI Джин клон кДНК в вектор клонированияHG15218-GRBS5130
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15218-NFRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15218-NHRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15218-NMRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15218-NYRBS13340
Человек SYT6 / Synaptotagmin VI Джин ORF экспрессии кДНК клона плазмидыHG15218-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15218-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».