Быстрый заказ

Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SYT10 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC101024
    Размер кДНК:1572bp
    Описание кДНК:Full length Clone DNA of Homo sapiens synaptotagmin X with N terminal HA tag.
    Синоним гена:SYT10
    Виды:Human
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SYT10 qPCR primers for gene expression analysis, HP104374 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15783-ACGRBS16760
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15783-ACRRBS16760
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15783-ANGRBS16760
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15783-ANRRBS16760
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15783-CFRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15783-CHRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15783-CMRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15783-CYRBS14710
    Человек SYT10 Джин клон кДНК в вектор клонированияHG15783-GRBS5130
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15783-NFRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15783-NHRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15783-NMRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15783-NYRBS14710
    Человек SYT10 Джин ORF экспрессии кДНК клона плазмидыHG15783-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15783-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».