Быстрый заказ

Text Size:AAA

Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SUMO4 Информация о продукте «Клон cDNA»
Размер кДНК:288bp
Описание кДНК:Full length Clone DNA of Homo sapiens SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) with N terminal Flag tag.
Синоним гена:IDDM5, SMT3H4, SUMO-4, dJ281H8.4
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13973-ACGRBS15396
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13973-ACRRBS15396
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13973-ANGRBS15396
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13973-ANRRBS15396
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13973-CFRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13973-CHRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13973-CMRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13973-CYRBS13343
Человек SUMO4 Джин клон кДНК в вектор клонированияHG13973-GRBS5132
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13973-NFRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13973-NHRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13973-NMRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13973-NYRBS13343
Человек SUMO4 Джин ORF экспрессии кДНК клона плазмидыHG13973-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13973-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.