Быстрый заказ

Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
ПаспортОбзорыСвязанные продуктыПротоколы
Человек SUMO2 Информация о продукте «Клон cDNA»
Размер кДНК:330 bp
Описание кДНК:Full length Clone DNA of Homo sapiens SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) with C terminal HA tag.
Синоним гена:HSMT3,Smt3A,SMT3B,SMT3H2,SUMO3
Участок рестрикции:KpnI + XbaI(6kb+0.33kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with SUMO2 qPCR primers for gene expression analysis, HP102143 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13443-ACGRBS15400
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13443-ACRRBS15400
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13443-ANGRBS15400
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13443-ANRRBS15400
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13443-CFRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13443-CHRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13443-CMRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13443-CYRBS13340
Человек SUMO2 Джин клон кДНК в вектор клонированияHG13443-GRBS5130
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13443-NFRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13443-NHRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13443-NMRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13443-NYRBS13340
Человек SUMO2 Джин ORF экспрессии кДНК клона плазмидыHG13443-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13443-CY
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.