After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SUMO1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003352.4
Размер кДНК:306bp
Описание кДНК:Full length Clone DNA of Homo sapiens small ubiquitin-like modifier 1 with N terminal Myc tag.
Синоним гена:DAP1, GMP1, PIC1, SMT3, UBL1, OFC10, SENP2, SMT3C, SMT3H3
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13095-ACGRBS15400
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13095-ACRRBS15400
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13095-ANGRBS15400
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13095-ANRRBS15400
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13095-CFRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13095-CHRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13095-CMRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13095-CYRBS13340
Человек SUMO1/SUMO-1 Джин клон кДНК в вектор клонированияHG13095-GRBS5130
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13095-NFRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13095-NHRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13095-NMRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13095-NYRBS13340
Человек SUMO1/SUMO-1 Джин ORF экспрессии кДНК клона плазмидыHG13095-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

Ссылки
  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.
  • Size / Price
    Каталог: HG13095-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».