After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SUB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010537
Размер кДНК:384bp
Описание кДНК:Full length Clone DNA of Homo sapiens SUB1 homolog (S. cerevisiae) with N terminal Myc tag.
Синоним гена:MGC102747, P15, PC4, p14, SUB1
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14326-ACGRBS15400
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14326-ACRRBS15400
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14326-ANGRBS15400
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14326-ANRRBS15400
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14326-CFRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14326-CHRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14326-CMRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14326-CYRBS13340
Человек SUB1 / PC4 Джин клон кДНК в вектор клонированияHG14326-GRBS5130
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14326-NFRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14326-NHRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14326-NMRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14326-NYRBS13340
Человек SUB1 / PC4 Джин ORF экспрессии кДНК клона плазмидыHG14326-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SUB1 belongs to the transcriptional coactivator PC4 family. It is a general coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. SUB1 binds single-stranded DNA. Single-stranded DNA-binding proteins play many roles in nucleic acid metabolism, but their importance during transcription remains unclear. SUB1 exhibits strong genetic interactions with factors necessary for promoter melting. It localizes near the transcription bubble in vitro and binds to promoters in vivo dependent upon preinitiation complexes assembly. SUB1 interacts with the nontemplate strand of RNApII complexes during initiation. It may also be involved in stabilizing the multiprotein transcription complex.

Ссылки
  • Knaus R, et al. (1996) Yeast SUB1 is a suppressor of TFIIB mutations and has homology to the human co-activator PC4. EMBO J. 15(8):1933-40.
  • Ge H, et al. (1994) Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes. Cell. 78(3):513-23.
  • Kaiser K, et al. (1994) A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators. Cell. 78(3):525-34.
  • Size / Price
    Каталог: HG14326-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».