Быстрый заказ

Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human STX8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC009713
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Homo sapiens syntaxin 8.
Синоним гена:CARB, STX8
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14243-ACGRBS15396
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14243-ACRRBS15396
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14243-ANGRBS15396
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14243-ANRRBS15396
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14243-CFRBS13343
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14243-CHRBS13340
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14243-CMRBS13340
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14243-CYRBS13340
Человек STX8 / Syntaxin 8 Джин клон кДНК в вектор клонированияHG14243-GRBS5132
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14243-NFRBS13340
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14243-NHRBS13340
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14243-NMRBS13340
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14243-NYRBS13340
Человек STX8 / Syntaxin 8 Джин ORF экспрессии кДНК клона плазмидыHG14243-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

Ссылки
  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Size / Price
    Каталог: HG14243-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».