Syntaxin 3 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

Syntaxin 3 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Human syntaxin 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Syntaxin 3 cDNA ORF Clone, Human, N-HA tag: Alternative Names

STX3A cDNA ORF Clone, Human

Syntaxin 3 Background Information

STX3, also known as syntaxin 3, belongs to the syntaxin family. STX3 is a target membrane protein (t-SNARE) which is needed for membrane fusion. Membrane fusion requires the formation of a complex between a vesicle protein (v-SNARE) and t-SNAREs. STX3, together with syntaxin 2, are predominantly localized at the plasma membrane. Syntaxin 2 cycles between the plasma membrane and the perinuclear compartment whereas syntaxin 3 cycles between the plasma membrane and the trans-Golgi network. It is possible that this cycling has an important role in the regulation of t-SNARE function.
Full Name
syntaxin 3
References
  • Ibaraki K. et al., 1995, Biochem Biophys Res Commun. 211 (3): 997-1005
  • Martín-Martín B. et al., 1999, J Leukoc Biol. 65 (3): 397-406.
  • Darios F. et al., 2006, Nature. 440 (7085): 813-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait