Быстрый заказ

Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human STX3 Информация о продукте «Клон cDNA»
Размер кДНК:870bp
Описание кДНК:Full length Clone DNA of Homo sapiens syntaxin 3 with N terminal HA tag.
Синоним гена:STX3A
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14625-ACGRBS15400
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14625-ACRRBS15400
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14625-ANGRBS15400
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14625-CFRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14625-CHRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14625-CMRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14625-CYRBS13340
Человек STX3 / Syntaxin 3 Джин клон кДНК в вектор клонированияHG14625-GRBS5130
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14625-NFRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14625-NHRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14625-NMRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14625-NYRBS13340
Человек STX3 / Syntaxin 3 Джин ORF экспрессии кДНК клона плазмидыHG14625-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

STX3, also known as syntaxin 3, belongs to the syntaxin family. STX3 is a target membrane protein (t-SNARE) which is needed for membrane fusion. Membrane fusion requires the formation of a complex between a vesicle protein (v-SNARE) and t-SNAREs. STX3, together with syntaxin 2, are predominantly localized at the plasma membrane. Syntaxin 2 cycles between the plasma membrane and the perinuclear compartment whereas syntaxin 3 cycles between the plasma membrane and the trans-Golgi network. It is possible that this cycling has an important role in the regulation of t-SNARE function.

  • Ibaraki K. et al., 1995, Biochem Biophys Res Commun. 211 (3): 997-1005
  • Martín-Martín B. et al., 1999, J Leukoc Biol. 65 (3): 397-406.
  • Darios F. et al., 2006, Nature. 440 (7085): 813-7.
  • Size / Price
    Каталог: HG14625-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.